Skip to main content

Table 2 Hybridisation conditions for oligonucleotide probes used in this study

From: A randomised, double-blind, placebo controlled cross-over study to determine the gastrointestinal effects of consumption of arabinoxylan-oligosaccharides enriched bread in healthy volunteers

Probe name Sequence (5’ to 3’) Hybridisation pre-treatment Formamide (%) for hybridisation Temperature (°C) Bacteria covered  
Hybridisation Washing
Ato291 GGTCGGTCTCTCAACCC Lysozyme 0 50 50 Atopobuim- Coriobacterium [33]
Bac303 CCAATGTGGGGGACCTT None 0 46 48 Bacteroides – Prevotella [34]
Bif164 CATCCGGCATTACCACCC Lysozyme 0 50 50 Bifidobacterium spp [35]
Chis150 TTATGCGGTATTAATCTYCCTTT None 0 50 50 Clostridium histolyticum- Clostridium perfringens [36]
Erec482 GCTTCTTAGTCARGTACCG None 0 50 50 Eubacterium rectale- Clostridium coccoides [36]
Lab158 GGTATTAGCAYCTGTTTCCA Lysozyme 0 50 50 Lactobacillus- Enterococcus [37]
Eco1531 CACCGTAGTGCCTCGTCATCA None 35 37 37 Escherichia coli [38]
Rrec584 TCAGACTTGCCGYACCGC None 0 50 50 Roseburia and Eubacterium rectale [39]
Fprau645 CCTCTGCACTACTCAAGAAAAAC Lysozyme 15 46 48 Faecalibacterium prausnitzzi [40]
EUB338‡ GCTGCCTCCCGTAGGAGT None 35 46 48 Total bacteria 1 [41]
EUB338II‡ GCAGCCACCCGTAGGTGT None 35 46 48 Total bacteria [41]
EUB338III‡ GCTGCCACCCGTAGGTGT None 35 46 48 Total bacteria [41]