Skip to main content

Table 1 Primer sequences for quantitative real-time RT-PCR

From: Combined ginger extract & Gelam honey modulate Ras/ERK and PI3K/AKT pathway genes in colon cancer HT29 cells

Gene Forward primer (F) Reverse primer (R)
GADPH TCCCTGAGCTGAACGGGAAG GGAGGAGTGGGTGTCGCTGT
Kras TAGTTGGAGCTGGTGGCGTA CCTCTTGACCTGCTGTGTCG
Erk ACAGGCTGTTCCCAAATGCT CGAACTTGAATGGTGCTTCG
Akt GTCGCCTGCCCTTCTACAAC CACACGATACCGGCAAAGAA
Bcl-xl GCATTGTGGCCTTTTTCTCC GCTGCTGCATTGTTCCCATA
Caspase 9 GAGGGAAGCCCAAGCTCTTT CACTGGGTGTGGGCAAACTA
P65 CCTGGGAATCCAGTGTGTGA GCACTGTCACCTGGAAGCAG
IκBα GAAGTGATCCGCCAGGTGAA CTCACAGGCAAGGTGTAGGG